Imprimir

São Paulo, 04 de fevereiro de 2010.


Prof. Dr. Zan Mustacchi
Presidente do Departamento Científico de Genética da SPSP

Dra. Patrícia Salmona
Secretária do Departamento Científico de Genética da SPSP


O domínio inacessível da biotecnologia no aspecto da genética molecular impõe aos pediatras constantes buscas pelo conhecimento que certamente traduz-se às resoluções de mais ampla rapidez e eficácia de diagnóstico permitindo a melhor opção terapêutica.

A preocupação do pediatra diante do paciente deficiente, principalmente intelectual, impõe acreditar na frase “We touch the future when we teach”, enfatizando a importância da inclusão, respeitando toda a diversidade dos modelos de capacitação e dos limites individualizados, reconhecendo as diferentes culturas e aspectos sócio-econômicos. O 12º Congresso Paulista de Pediatria oportunizará uma atualização que permitirá traduzir conhecimentos baseados em evidências da genética molecular e da resiliência sócio-educacional promovendo bases para o empoderamento, aplicando diretamente a melhoria da qualidade de vida, além da reciclagem e atualização médica.

Autor: Prof. Dr. Zan Mustacchi e Co-autora: Dra. Patrícia Salmona.

Publicações

"A Síndrome de Eagle na Síndrome de Down – Relato de Caso" ("Eagle´s Syndrome in Down's Syndrome – Case Report" - Autores: Fabiane Priscila Tiago SANTOS, Zan MUSTACCHI, Clóvis MARZOLA, Lucy Dalva Lopes MAURO, Arnaldo GUILHERME

• Embriões ou célula tronco, uma questão de bom senso

• I Congresso Internacional Aprendendo Down do Sul da Bahia - Cidadão Down, uma realidade - 23 a 25/11/2006

• Estimulação Essencial - Autora: Dra. Roberta Mustacchi

• Protocolo Clínico de seguimento médico em síndrome de Down

• "Tay-Sachs disease in Brazilian patients: Prevalence of the IVS7+1g>c mutation"
Autores: ROSENBERG, R.; MARTINS, A.; MICHELETTI, C.; MUSTACCHI, Z.; PEREIRA, L.V. (2004).


• Trabalhos publicados nos anais do "IV Congresso Brasileiro sobre Síndrome de Down - Salvador/BA - 09-11/09/2004"


Índice dos Tópicos:

• Abordagem terapêutica do método HWTEARS (Handwriting without tears method)
• Amigos
• Aprendendo com o Educador
• A Importância da Massagem para o Casal Durante a Gestação
• A Sexualidade dos deficientes vista de frente
• Cognição
• Como comportar-se
• Como Estamos e o que Queremos?
• Cuidado Bucal Para Crianças
• Declaração de Madri
• Deficiência
• Determinantes Sociais do Comprometimento Intelectual
• Dicas de Escovação
• Dogmas Nutricionais 1
• Epidemia de Gripe
• Estresse e Terapias Alternativas
• Hidroterapia na Síndrome de Down
• Informações Importantes sobre Prevenção de Malformações
• Novidades em Síndrome de Down
• O Comprometimento na População
• O Elo do Aprendizado
• O Estado da Prevenção
• Passos para a Inclusão
• Pensando em Inclusão
• Promovendo a Igualdade
• Reformando para Incluir
• Será mesmo que dominamos o genoma?
• Se Você não cuidar de seu corpo, onde irá viver?
• Teratogênese - Malformações de Origem Ambiental
• Terapia Ocupacional: uma breve apresentação" - autoras: Dra. Andréa Saigh Jurdi e Dra. Fabiana Abreu P. de Alencar
• Todos Podem Aprender
• Toque - Sentindo e Ouvindo as Cores
• Transformando-se num ser sócio-sexual
• Uma Questão de Nobreza
• Voluntariado


Fechar Janela



EPIDEMIA DE GRIPE

A recomendação da OMS (Organização Mundial de Saúde) para a vacinação este ano no hemisfério sul é que as vacinas contenham os vírus inativados similares aos das seguintes cepas:

- A/Sidney/5/97 como vacinação contra vírus H3N2
A/Nova Caledonia/20/99 como vacinação contra vírus H1N1
B/Beijing (Pequim)/184/93 ou B/Shandong/7/97

Estas vacinas ainda estão em elaboração e somente estarão disponíveis em nosso meio a partir de março. Existem vacinas antigas, com outras cepas, que devem conferir preteção de menor efeito às cepas que agora afetam o hemisfério norte e só devem ser tomadas por pessoas que vão viajar para lá, preferentemente 15 dias antes da viagem. Vacinas com cepas adequadas estarão disponíveis no nosso meio desde março de 2000.

Existem medicamentos que podem ser usados como profilaxia ou como tratamento da influenza. A amantadina e a rimantadina só são úteis na profilaxia ou tratamento de gripe causada pelo vírus Influenza. A, com uma efetividade de 20 a 60% em relação ao placebo na prevenção quando tomadas no início de um surto e por duas semanas até o decréscimo de atividade do surto ou epidemia. Se forem usadas no tratamento só funcionam se tomadas nas primeiras 48 horas após o início dos sintomas e o efeito observado é a redução da duração da febre em 1.3 dias. O tratamento deve ser feito no máximo por 5 dias, ou 24 a 48 horas após o fim dos sintomas. Duas novas drogas, inibidoras da neraminase viral (enzima essencial à reaplicação viral), podem ser usadas para profilaxia e tratamento: o zanamivir e o oseltamivir, a despeito de serem pequenos os estudos já divulgados. Nos Estados Unidos, o zanamivir é aprovado para tratamento de doença aguda não complicada em maiores de 12 anos de idade, entre os que estiverem sintomáticos por menos de 2 dias. É ministrado por inalação, na dose de duas inalações por dia, por 5 dias e pode causar broncoespasmo, de modo que deve ser usado com muita cautela em asmáticos ou pacientes com doenças pulmonares obstrutivas crônicas como a bronquite e o enfisema.

O aseltamivir é aprovado para a mesma situação clínica, só que somente para adultos (>17 anos de idade). É dado por via oral, 75mg (um comprimido) duas vezes ao dia, por 5 dias e não deve ser usado em pacientes com insuficiência renal crônica grave (depuração de creatinina menor que 10ml/min). A droga pode causar náuseas e vômitos e deve ser tomadas às refeições.

A FDA (Food and Drug Administration dos EUA) deixou claro que as drogas anti-virais não previnem as infecções bacterianas pulmonares que se seguem à influenza e só tem mostrado-se efetivas se iniciadas precocemente, ou seja, até no máximo 48 horas do início dos sintomas. O benefício destas drogas tem sido um discreto encurtamento do tempo de doença excreção viral. Nenhuma delas foi aprovada para uso preventivo da gripe.


Prof. Dr. Zan Mustacchi    TOPO


Questões que podem ajudar os pais e familiares a se conscientizarem para auxiliar seus filhos no caminho da vida autônoma, autodirigida e independente


• A síndrome de Down concentra toda ou quase toda a atenção de sua família?

• Você se informa e se capacita sobre o tema da síndrome de Down?

• Luta pelos direitos do seu filho com comprometimento intelectual junto a instituições e profissionais?
• Trata o seu filho como um membro a mais da família apesar de suas dificuldades? Sabe que isso o ajuda a crescer? Os irmãos participam da educação do filho com síndrome de Down?

• São oferecidas a ele as mesmas oportunidades que a seus outros filhos?

• Você põe limites e exige de seu filho com síndrome de Down como dos outros filhos?

• Ele recebe responsabilidade nas tarefas de casa?

• Você participa com os professores e profissionais envolvidos na tomada de decisões a respeito da educação que recebe seu filho com síndrome de Down?

• Promove situações de aprendizagem cotidiana em que ele aplica suas próprias estratégias?

• Propõe a seu filho com síndrome de Down atividades novas e divertidas baseando-se em seus interesses e preferências?

• Permite que seu filho com síndrome de Down tome decisões, ainda que com risco de que não sejam as mais acertadas?

• Você respeita suas iniciativas?

• Promove e estimula as relações de amizade de seu filho com síndrome de Down?

• Você lhe ensina habilidades sociais e promove situações para praticá-las?

• Facilita atividades e programas de lazer para seu filho com síndrome de Down?

• Valoriza o que faz seu filho com síndrome de Down e deixa isso claro para ele?

• Você o trata de acordo com a idade que ele tem? Respeita sua privacidade?

• Está disposto a aceitar que seu filho com síndrome de Down tenha uma parceira? Dá-lhe acesso a informações sobre sexualidade?

• Permite-lhe que maneje dinheiro para suas necessidades cotidianas?

• Permite-lhe uma boa formação para facilitar sua inserção no mercado de trabalho?

• Prioriza em sua formação suas preferências e interesses?

• Você faz seu filho com síndrome de Down participar das diferentes situações que sua família vivencia?

Estas perguntas foram elaboradas a partir do texto “LAS 12 CLAVES PARA LA AUTONOMÍA DE LAS PERSONAS COM SÍNDROME DE DOWN – FEISD – Espanha”.

Prof. Dr. Zan Mustacchi     TOPO


PENSANDO EM INCLUSÃO

     Existe um consenso evolutivo, em nossa civilização, de que a produtividade é essencial.
     A criança especial beneficia-se de oportunidades existentes, desde que a sociedade lhe permita participar e demonstrar seu potencial de colaboração. Lembrando que a principal motivação para a vida educacional está no prazer dos resultados das oportunidades que nos são apresentadas e valorizadas pela comunidade.
     Os limites impostos aos indivíduos, desde o nascimento, envolvendo, principalmente, as áreas de aprendizado e sociabilidade, não devem ser rigorosos e imperativos a ponto de preocupar os familiares de portadores de comprometimentos. Devem ser flexíveis até o ponto em que não se prejudique a integridade do indivíduo que necessita de estimulação constante, para promover sua adesão ao ambiente em que vive, estimulando a inclusão de todos em tudo.
     A idéia de inclusão escolar deve gerar a oportunidade do conhecimento especial às habilidades individuais para inserir o indivíduo diretamente à vida. Os professores deverão crescer em escolas cujo reconhecimento da atividade bem sucedida gerem uma espécie de remédio que assegure, de forma aglutinadora, a ambição com motivação.

Prof. Dr. Zan Mustacchi    TOPO


PASSOS PARA A INCLUSÃO

     Alguns pais, de forma intuitiva, percebem que o ensino inclusivo necessariamente beneficiará o seu filho deficiente, dando-lhe oportunidades para obter uma sociabilização comunitária.
     A relação entre alunos com e sem deficiência proporciona experiências singulares, que geram modelos de apoio educacional muito mais adequado do que quando ocorre a segregação. É preciso entender que, a simples 'inclusão' dos deficientes em sala de aula regular, não necessariamente resultará em benefício de sua aprendizagem, mas terá um fator de desenvolvimento de habilidades e atitudes positivas na preparação da vida comunitária; justamente porque proporcionará, através da comunicação e do desenvolvimento de amizades, uma orientação com relação ao respeito, a compreensão, a sensibilidade e a motivação.
     Para os alunos com uma grave deficiência cognitiva é preciso acreditar no benefício que estes alunos virão a obter, principalmente da socialização com seus colegas e, em especial para estes alunos, não é conveniente que o professor preocupe-se com habilidades acadêmicas, o importante e o mais razoável é oferecer-lhes a oportunidade de adquirirem habilidades sociais para a vida comunitária.
     Os locais onde há segregação geram prejuízos por alienarem os alunos e limitam o aprendizado do aluno sem deficiência, por não lhe oferecer a fundamental experiência da diversidade, cooperação e respeito necessário para interagir com os deficientes.

Prof. Dr. Zan Mustacchi     TOPO


PROMOVENDO A IGUALDADE

     Promover o respeito da igualdade do aluno é, sem dúvida nenhuma, um dos deveres da educação escolar e, portanto, o acesso à informação e formação educacional deve ser promovido sem triagem prévia, de forma irrestrita para todos os alunos, sem discriminação para com os alunos deficientes.
     Vivemos numa cultura fotográfica, onde a principal restrição é bem caracterizada quando um aluno portador de um estigma fenotípico (com uma face diferente, ou mesmo que caracterize uma síndrome genética do tipo Down) tem seu acesso limitado, portanto simplesmente discriminatório, caracterizando que o preconceito está inserido não só na inconsciência como na consciência, resultando em conflitos sociais onde o valor da igualdade é desrespeitado.
     Quando um professor é exposto a este tipo de situação ele deve lembrar que as suas habilidades profissionais serão postas em questão, entretanto melhorarão devido às grandes transformações sociais que esta oportunidade lhes desenvolverá; principalmente devido às suas atitudes e práticas educacionais que serão moldadas, envolvendo conceitos retrospectivos e prospectivos, vinculados com o nível e com o potencial de desenvolvimento de cada indivíduo; promovendo um desafio que deve ser enfrentado pelos educadores, onde a abordagem de sua própria reforma interna possa ser fragmentada, mas inteiramente satisfatória, entendendo e reconhecendo as necessidades das diferentes situações, utilizando para isso a dinâmica e a habilidade da aptidão cognitiva.

Prof. Dr. Zan Mustacchi    TOPO

Terapia Ocupacional: uma breve apresentação

Autoras:    Andréa Saigh Jurdi e Fabiana Abreu P. de Alencar
   Terapeutas Ocupacionais do CEPEC - SP



A Terapia Ocupacional é uma profissão da área da saúde que atua na prevenção, no tratamento e na reabilitação. Atende, através de tecnologias orientadas, pessoas que necessitam de atenção com relação aos problemas físicos, mentais, sensoriais e emocionais, que têm limitadas suas atividades e a participação social. As intervenções dimensionam-se pelo uso de atividades, elemento orientador na construção do processo terapêutico.

O terapeuta ocupacional analisa e adapta a atividade a cada indivíduo e situação, observando e determinando os aspectos motores, psíquicos, sensório-perceptivos, socioculturais, cognitivos e funcionais necessários à realização da mesma.

A Terapia Ocupacional tem por objetivo tornar a vida das pessoas mais participativa e acessível, facilitando o desempenho e ampliando capacidades(*).

Na área da infância a Terapia Ocupacional, através de sua prática clínica, pode beneficiar as crianças desde o início da vida. Dentre suas atribuições destacamos algumas que ilustram o processo terapêutico.

A Terapia Ocupacional através de atividades direcionadas:

  • Facilita a interação criança-ambiente, provocando na criança ações com intencionalidade e postura ativa.
  • Favorece a exploração organizada.
  • Propõe atividades que estimulam habilidades cognitivas.
  • Favorece as áreas da atenção e concentração, reduzindo a frustração.
  • Amplia o repertório de experiências sensoriais e cinestésicas, fazendo com que a criança construa movimentos com propósito, integrando habilidades motoras e sensoriais.
  • Facilita a descoberta da função dos objetos.
  • Estimula o amadurecimento e o desenvolvimento global, favorecendo tanto a independência quanto a aquisição de habilidades motoras finas.
  • Orienta pais e familiares em relação às atividades diárias.
  • Atua junto à rede social, favorecendo a inclusão.

(*) Fonte: Conselho Regional de Fisioterapia e Terapia Ocupacional (CREFITO3).


Venha conhecer o nosso trabalho!


Centro de Estudos e Pesquisas Clínicas de São Paulo – CEPEC-SP
Rua Morishigue Akagui, 59 – Morumbi – São Paulo/SP – CEP: 05615-140
Telefones: (11) 3721-3589 / 3721-6200 – Fax: 3721-9175
www.sindromededown.com.br // terapia.ocupacional@drzan.com.br




A criança é diferente?! Difícil?
A criança é especial?!
Doente?
O ensino é diferente?
A educação é especial?
TODOS PODEM APRENDER


     Nossas dificuldades vinculam-se aos modelos didáticos, utilizados universalmente como padrões de ensino.
     Imaginem (mãe ensinando o filho a falar): - Meu filho, "eu sou, tu és, ele é, nós somos, vós sois, eles são". E se ele "ousar" tentar aprender tal como "nós sois", lá vai 'a bronca', 'a chamada', nossos antigos 'puxões de orelhas' e etc. Não queremos mais nos expor!...
     Entretanto, se "mamãe canta": Parabéns pra você..., O pato vinha cantando alegremente...; Ou até: A de 'amor', B de 'baixinho'..., Balança, balança ...; com um ritmo agradável, sem risco de punição, eles aprendem tudo!!!
     Lembrem que tivemos (todos que completamos o 2º grau) aulas de 'línguas' estrangeiras (francês, alemão ou algumas de latim e principalmente inglês) e quem de nós aprendeu (considerando-se somente as aulas da escola)? Tivemos cerca de quatro anos de língua estrangeira e em quatro anos não aprendemos. Pois é... tentaram nos ensinar a gramática de alguma língua estrangeira sem mesmo sabermos falá-la, ou melhor, sem entendermos nenhuma palavra desta língua! Será que fomos todos deficientes? Obviamente que não. Deficiente foi e é o modelo pelo qual nos é proposto este ensinamento.

Prof. Dr. Zan Mustacchi     TOPO


COGNIÇÃO

     O portador de comprometimento intelectual, caracterizado pela OMS (Organização Mundial de Saúde) como 'deficiente mental' e também definido na literatura como 'criança especial' ou 'criança diferente', apresenta primariamente um déficit de cognição, que de acordo com André Guilherme Polito (Autor de: Melhoramentos: Minidicionário de Sinônimos e Antônimos, São Paulo, 1994) significa: 'compreensão, entendimento, percepção, conhecimento'. E se consultarmos um série de outros dicionários, cada qual tentará, usando da mais ampla gama de vocábulos, explicar o que é 'cognição' e, consequentemente, não temos uma "melhor" definição.
     Tentaremos fazer uso de modelos, para que possamos entender melhor esse termo tão usado e de certa forma "impalpável".
     Quando pergunto-lhes "Como é a pia do seu banheiro, isto é, quantos registros e quantas torneiras existem em sua pia?", terei duas possíveis respostas: a primeira será "1 registro e 1 torneira", óbvia e sem questionamentos; e a segunda será "2 registros e 1 torneira", situação esta que obviamente permite-nos a seguinte pergunta "Por que 2 registros e 1 torneira?", e a resposta, na grande maioria das vezes será "Para termos água quente e água fria"; traduzindo-se, portanto, essa última situação como sendo a de um 'misturador de água'. Essa resposta é aquela que esperávamos, entretanto a segunda resposta, que será "Para termos mais água", também é correta e lógica, mas não nos satisfaz e este é o clássico modelo relacionado ao comprometimento cognitivo existente nesta segunda resposta. Seguindo-se a mesma linha de raciocínio, poderemos complementar com a pergunta "Como sabemos qual é o de água quente?", a melhor resposta que qualifica uma boa cognição é, necessariamente, aquela que definirá a diferença caracterizando uma "marca", no caso será "um ponto" de cor vermelha para o registro de água quente ou de cor azul para o de água fria. Esta situação novamente expressa um modelo de capacitação cognitiva, que está comprometida na população que teremos que aprender a ensinar.

Prof. Dr. Zan Mustacchi     TOPO


DETERMINANTES SOCIAIS DO COMPROMETIMENTO INTELECTUAL

     Criticar o que até agora tem sido feito no campo da assistência ao portador de comprometimento físico e/ou intelectual (deficiente físico e/ou deficiente mental - OMS) é, ao mesmo tempo, prestar-lhe um serviço e pagar-lhe um tributo. Prestar-lhe um serviço, porque ajudará a causa dos deficientes e pagar-lhe um tributo, porque demonstrará o desejo que estimula a todos nós de fazer cada vez mais.
     A crítica, em resumo, é uma profissão de fé, não só nos direitos dos deficientes, mas também nos direitos de qualquer pessoa prejudicada, seja por motivos raciais, étnicos, religiosos ou sócio-econômicos, seja por invalidez física ou mental.
     A capacidade de percepção lógica, de racionalização e de reestruturação dos dados perceptivos, bem como a capacitação motora, auditiva, olfativa, gustativa, táctil e visual, quando comprometidas, tem alicerces sociais tão profundos em nosso meio que justificam a inclusão do Brasil entre os países de sobreviventes.
     Inúmeras são as variantes que comprometem a aptidão para aprender, a qual está certamente apoiada em dois aspectos fundamentais da Saúde Pública: um de caráter constitucional e outro de caráter ambiental. O aspecto constitucional pode ser, por sua vez, genético ou hereditário; lembrando que nem todo fator genético é necessariamente hereditário. O aspecto ambiental, tem importância especial, pois pode ser modificado pela educação, pelo sanitarismo (saúde e higiene), pela nutrição e por fatores sócio-econômicos.

Prof. Dr. Zan Mustacchi     TOPO


COMO ESTAMOS E O QUE QUEREMOS?

     A cada minuto nascem 100 crianças, das quais 20% morrem no primeiro ano; 70% dos sobreviventes não terão assistência médica e serão mal nutridos (passarão fome); estes, por sua vez, estarão sujeitos a danos físicos e mentais.
     A fome e a falta da educação produzem a miséria social, que traz em seu topo a 'deficiência'.
     Como salientamos, os problemas suscitam as críticas que, por sua vez, alertam, podendo revelar propostas e, muitas vezes, soluções.
     Soluções que, ao nosso ver estão na prevenção intervencionista e de certa forma radical, alicerçada em sólida base ética e que promova necessariamente a educação familiar e aconselhamento, mudanças na atitude e educação dos profissionais e técnicos, uso de tecnologia biomédica e instrutiva.
     Para atenuar essa situação é preciso promover atenção médica materno-infantil, aconselhamento genético e nutricional por equipes especializadas; além da habilitação, integração e inclusão do deficiente (comprometido intelectual e/ou físico).

Prof. Dr. Zan Mustacchi     TOPO


O COMPROMETIMENTO NA POPULAÇÃO

     Conforme dados da Organização Mundial de Saúde, quando a nossa população era de 130 milhões de habitantes, havia 13 milhões (10% de deficientes na população), dos quais 50% (6,5 milhões) eram portadores de deficiência mental, perfazendo 5% do total de habitantes; 2% de deficiência física; 1,3% de deficiência auditiva: 0,7% de deficiência visual e 1% de deficiências múltiplas. Desta forma, cerca de ¼ (25% de nossa população) estão, de certa forma, intimamente comprometidos, considerando-se que o coeficiente populacional indica algo em torno de 4,2 pessoas por família. Dos coeficientes, 8,7 milhões não recebem qualquer tipo de atendimento e somente 4,3 milhões (aproximadamente 50%) tem um atendimento considerado razoável.
     É importante ressaltar que inúmeras anomalias congênitas e genéticas seriam evitadas com o aspecto educativo e que, principalmente a síndrome de Down, que ocorre na prevalência de 1/600 nascidos vivos na última década, em nosso país, seria responsável pela frequência de 2% de toda a população com algum tipo de comprometimento.
     No Brasil, como em qualquer outro país, a saúde tem aspectos políticos, mas para que possamos melhorá-la, devemos desvinculá-la do partidarismo, de modo que os sucessivos governos fiquem comprometidos com o programa de educação, saúde e prevenção.

Prof. Dr. Zan Mustacchi    TOPO


DEFICIÊNCIA

    É provável que 2 a 3% dos nascidos vivos apresentam, ao nascer, uma ou mais malformações congênitas importantes e, a partir do primeiro ano, esse número duplique ao surgirem alterações que passam inadvertidas no recém-nato.
     Malformações congênitas são defeitos anatômicos macroscópicos intrínsecos, presentes nos recém-nascidos. Deformidades são anomalias congênitas determinadas por fatores extrínsecos atuando sobre tecido normal, comprometendo sua morfogênese.
     As malformações congênitas decorrem de diversos fatores. Cerca de 10% delas, estão subordinadas a fatores ambientais; 10% a fatores genéticos e cromossômicos; e 80% são causadas por uma interação complicada de fatores genéticos e ambientais.

Prof. Dr. Zan Mustacchi     TOPO


TERATOGÊNESE - MALFORMAÇÕES DE ORIGEM AMBIENTAL

     Entre os fatores ambientais destacam-se, por sua comprovada ação teratogênica, os seguintes: agentes infecciosos, radiações ionizantes, agentes químicos, hormônios, anticorpos e, provavelmente, desnutrição e hipóxia.
     O tipo de comprometimento produzido por estes é denominado lesão, que corresponde ao distúrbio morfológico de um órgão, parte de um órgão ou de uma região mais extensa do corpo, resultante de uma falha extrínseca no mecanismo normal de desenvolvimento ou de interferência nele.
     Dentre os fármacos perigosos quando usados por gestantes, citam-se principalmente: talidomida: antiemético e sonífero; quinina: antimalárico; aminopterina: antagonizante do ácido fólico; busulfan e tolbutamida: usados na leucemia e diabetes; dietilbestrol e outros.
     Importante destaque deve ser dado ao álcool, desencadeador de anormalidades tais como: retardo dos crescimentos pré e pós-natal, pequenos índices de Apgar, amamentação débil, à síndrome Alcoólica Fetal anormalidades esqueléticas, anomalias cardíacas (geralmente defeitos septais) e do trato genito-urinário (grandes lábios hipoplásicos, hipospadias).

Prof. Dr. Zan Mustacchi    TOPO


Se Você não cuidar de seu corpo, onde irá viver?

SYLVANIA KABILJO
Terapeuta e Educadora do CEPEC-SP (Centro de Est. e Pesq. Clín. de S. Paulo);
Graduada pela FFLCH/USP e Licenciada pela Faculdade de Educação da USP; Consultora em Metafísica da Saúde, especializada nas áreas de: Acupuntura Auricular, Shiatsu, Shantala, Cromoterapia, Florais de Bach, Reflexologia, Moxabustão e Ventosa.


Seu corpo é a única coisa que você manterá por toda sua vida. Disso você já sabe, mas será que você realmente se dá conta da importância disso? Não podemos dizer isso de mais nada - seu carro, sua casa, sua família, seu "amorzinho", seus bens, seu discurso, tudo isso vai passando. Seu corpo continua aí...

Seus valores mudarão, você vai trocar ainda muitas crenças, trocará pensamentos, muitos gostos vão mudar, muitas prioridades, enfim quase tudo.

Seu corpo continuará... O mesmo corpo... Pode ser que esteja melhorado, renovado... ou não.

Seus sentimentos também mudarão, serão transformados e você não sabe, de verdade, do que é que estará gostando, curtindo, querendo daqui a um ano, seis meses, uma semana, amanhã!!! Entre hoje e amanhã você poderá experimentar uma frutinha que tenha um gosto tão bom para você que pode ser que ela nunca mais saia da sua cabeça e da sua vontade. Ou você acha que nada mais vai te surpreender? Pode ser uma frutinha pequenininha, ou pode ser um olhar, um sorriso, pode ser uma expressão de alguém conhecido ou não; o fato é que seu mundo de pensamentos e emoções será outro daqui a pouco. Você estará diferente logo mais... E o seu corpo...Será o mesmo.

Ele também vai mudando, se transformando, muito mais pelo efeito dos seus pensamentos, de suas crenças e de seus sentimentos, do que pelo passar do tempo ou pela lei da gravidade.

Será que você faz idéia do quanto o estado do seu corpo é resultado das suas crenças? Todos os dias à nossa volta temos exemplos de gente com aparência mais jovem que a idade cronológica, pessoas rejuvenescendo dia a dia e também o contrário - velhos de vinte e poucos anos e jovens com mais de setenta. A opção é pessoal.

Em que você acredita???

Você está cuidando bem do seu corpo?

Seu corpo está funcionando bem?

Como está seu nível de energia e disposição?

Você se alimenta com atenção e respeito ao seu corpo ou só "mata a fome"?

O que você sente que precisa melhorar? Seu nível de energia ou sua aparência? Os dois?

Neste mundo físico, a única coisa que te acompanha desde o seu nascimento até a morte é o seu corpo. Você o trata como um amigo? Ou apenas o usa, como um utensílio qualquer?

Nosso corpo funciona como um canal de energia. Captamos essa energia de várias formas, sendo as mais palpáveis a respiração e a alimentação. Sem bloqueios essa energia flui de maneira espontânea, suave, equilibrada, criativa. Quando bloqueado o fluxo, por qualquer motivo, essa energia não-expressa começa a gerar desconforto, desequilíbrio, dor, deformação, sintomas psicossomáticos, doenças. Para restabelecer os níveis bons de energia, o primeiro trabalho a ser feito é o de remoção dos obstáculos ao fluxo natural desta energia pelo corpo. À nossa primeira percepção destes bloqueios internos chamamos de tensão...

Qualquer tensão ou desconforto reduz sua vitalidade, funcionando como um vazamento de energia. As tensões surgem principalmente nos campos mentais e emocionais, e, ao atingirem o corpo físico, reduzem em todos os níveis seus potenciais de atuação e presença na vida.

Como vencer o desconforto gerado pelas tensões? Temos duas formas principais de reduzir este desconforto:

1) Conscientizar-se das causas e atuar efetivamente para vencê-las (este é o trabalho inteligente) ou;

2) Deixar do jeito que está e fazer outras coisas, desfocando a atenção, ou seja, reduzindo o próprio nível geral de energia e consciência. Muitas vezes esta opção parece mais fácil e rápida, e, para reduzir a tensão, mergulhamos em outras fontes de prazer imediato como busca constante de emoções fortes (filmes, jogos, videogames), trabalhar demais, leitura compulsiva, vícios, excesso de exercícios físicos, comer demais, drogas e outras compulsões.

Dependendo das opções feitas encontramos prazer genuíno, embora o desgaste a curto, médio ou longo prazo seja certo e previsível. Outras opções levam a caminhos de desequilíbrio físico/psíquico gerando sintomas psicossomáticos dos mais diversos e inteiramente personalizados.

Equilíbrio no trato com seu corpo e satisfação com isso só se torna possível quando você o escuta. E o corpo está sempre respondendo. Nossos sentidos estão baseados no corpo (corpo-alma) e respondendo através dele.

Nosso corpo sempre indica o melhor para nós. O corpo sabe indicar o bom, e está continuamente fazendo isso. O bem é sensorial. Antes de qualquer pensamento o corpo já respondeu. Sempre. Repare... Ouça mais seu corpo. O corpo é a parte palpável da alma... Aprenda a ouvir seus sinais.

Corpo, mente e alma formam uma unidade e a separação corpo-mente-alma é apenas didática. Restabelecer a unidade corpo-mente-alma, percebendo e aceitando a sabedoria corporal, é o objetivo primeiro na busca de um bem-estar realmente significativo.

Para ajudá-lo neste processo, além destas dicas e reflexões, o CEPEC, através da educadora e terapeuta Sylvania Kabiljo, oferece diversas opções de terapias corporais para reativar, desestressar, auxiliar na sensibilização integral à sabedoria corporal.

Quando nos propomos a ouvir mais o próprio corpo os resultados são no mínimo revitalizantes e muitas vezes surpreendentes. Permita-se, afinal ...


    TOPO


O ESTADO DA PREVENÇÃO

     Apesar dos avanços recentes na promoção de uma medicina altamente sofisticada, baseada em modelos preestabelecidos, provenientes de grandes centros, onde prevalece a tecnologia e a auto-suficiência, em nosso meio ainda persistem conceitos fundamentais da prevenção na área da saúde, que devemos relembrar.
     No campo da prevenção, sabe-se que quanto maior o investimento, melhor serão os resultados práticos, em relação à saúde, aprendizagem e, consequentemente, à produtividade dos indivíduos na comunidade.
     Bem menos enfatizado, mas não menos importante, é o trabalho de reparação, na abordagem da criança deficiente. Essa reparação deve compreender uma melhor elucidação quanto aos processos anormais de desenvolvimento embrionário, utilizando mecanismos apropriados de investigação diagnóstica, que permitiriam aos profissionais da saúde empregar medidas adequadas, propiciando a esta população melhor adaptação à sociedade com uma adequada condição educacional.

Prof. Dr. Zan Mustacchi    TOPO



PENSANDO EM INCLUSÃO

Existe um consenso evolutivo, em nossa civilização, de que a produtividade é essencial.
A criança especial beneficia-se de oportunidades existentes, desde que a sociedade lhe permita participar e demonstrar seu potencial de colaboração. Lembrando que a principal motivação para a vida educacional está no prazer dos resultados das oportunidades que nos são apresentadas e valorizadas pela comunidade.
Os limites impostos aos indivíduos, desde o nascimento, envolvendo, principalmente, as áreas de aprendizado e sociabilidade, não devem ser rigorosos e imperativos a ponto de preocupar os familiares de portadores de comprometimentos. Devem ser flexíveis até o ponto em que não se prejudique a integridade do indivíduo que necessita de estimulação constante, para promover sua adesão ao ambiente em que vive, estimulando a inclusão de todos em tudo.
A idéia de inclusão escolar deve gerar a oportunidade do conhecimento especial às habilidades individuais para inserir o indivíduo diretamente à vida. Os professores deverão crescer em escolas cujo reconhecimento da atividade bem sucedida gerem uma espécie de remédio que assegure, de forma aglutinadora, a ambição com motivação.

Prof. Dr. Zan Mustacchi     TOPO

  

PASSOS PARA A INCLUSÃO

Alguns pais, de forma intuitiva, percebem que o ensino inclusivo necessariamente beneficiará o seu filho deficiente, dando-lhe oportunidades para obter uma sociabilização comunitária.

A relação entre alunos com e sem deficiência proporciona experiências singulares, que geram modelos de apoio educacional muito mais adequado do que quando ocorre a segregação. É preciso entender que, a simples ‘inclusão’ dos deficientes em sala de aula regular, não necessariamente resultará em benefício de sua aprendizagem, mas terá um fator de desenvolvimento de habilidades e atitudes positivas na preparação da vida comunitária; justamente porque proporcionará, através da comunicação e do desenvolvimento de amizades, uma orientação com relação ao respeito, a compreensão, a sensibilidade e a motivação.

Para os alunos com uma grave deficiência cognitiva é preciso acreditar no benefício que estes alunos virão a obter, principalmente da socialização com seus colegas e, em especial para estes alunos, não é conveniente que o professor preocupe-se com habilidades acadêmicas, o importante e o mais razoável é oferecer-lhes a oportunidade de adquirirem habilidades sociais para a vida comunitária.

Os locais onde há segregação geram prejuízos por alienarem os alunos e limitam o aprendizado do aluno sem deficiência, por não lhe oferecer a fundamental experiência da diversidade, cooperação e respeito necessário para interagir com os deficientes.

Prof. Dr. Zan Mustacchi     TOPO

 

PROMOVENDO A IGUALDADE

Promover o respeito da igualdade do aluno é, sem dúvida nenhuma, um dos deveres da educação escolar e, portanto, o acesso à informação e formação educacional deve ser promovido sem triagem prévia, de forma irrestrita para todos os alunos, sem discriminação para com os alunos deficientes. Vivemos numa cultura fotográfica, onde a principal restrição é bem caracterizada quando um aluno portador de um estigma fenotípico (com uma face diferente, ou mesmo que caracterize uma síndrome genética do tipo Down) tem seu acesso limitado, portanto simplesmente discriminatório, caracterizando que o preconceito está inserido não só na inconsciência como na consciência, resultando em conflitos sociais onde o valor da igualdade é desrespeitado.

Quando um professor é exposto a este tipo de situação ele deve lembrar que as suas habilidades profissionais serão postas em questão, entretanto melhorarão devido às grandes transformações sociais que esta oportunidade lhes desenvolverá; principalmente devido às suas atitudes e práticas educacionais que serão moldadas, envolvendo conceitos retrospectivos e prospectivos, vinculados com o nível e com o potencial de desenvolvimento de cada indivíduo; promovendo um desafio que deve ser enfrentado pelos educadores, onde a abordagem de sua própria reforma interna possa ser fragmentada, mas inteiramente satisfatória, entendendo e reconhecendo as necessidades das diferentes situações, utilizando para isso a dinâmica e a habilidade da aptidão cognitiva.

 Prof. Dr. Zan Mustacchi     TOPO



APRENDENDO COM O EDUCADOR

Os alicerces da inclusão estão apoiados em alguns princípios básicos, onde o aprendizado e o ensino são pertinentes a todos, não permitindo nenhum modelo de isolamento e/ou segregação.

As questões desafiadoras que são enfrentadas, tanto pelos alunos quanto pelos professores, residem basicamente no reconhecimento e interpretação dos distúrbios de aprendizado expressos pelo aluno e do valor da formação profissional do educador, bem como da sua experiência, paciência, tempo e esforço em busca de respostas.

O educador jamais deve alienar-se das hipóteses diagnósticas pertinentes aos comprometimentos de seus alunos, considerando que estas hipóteses podem justificar atitudes e modelos que favoreçam o seu melhor desempenho, cujo resultado não pode negligenciar qualquer forma consistente de modelo educativo previamente conhecido.

Como já referimos em textos anteriores, o professor não pode apegar-se a um currículo fixo e deve engajar-se a modelos inovadores, com improvisação voltada a necessidades gerais do aluno, visando proporcionar basicamente uma educação e não necessariamente um aprendizado acadêmico. Por outro lado a escola deve proporcionar aos membros da comunidade e, principalmente, aos seus educadores, a oportunidade de propor planos estratégicos de abrangência objetiva e específica, tentando desenvolver e implementar uma programação receptiva aos alunos, com recursos proporcionados pelo próprio ambiente, pelos professores e eventuais facilitadores, muitas vezes chamados de mediadores.


Prof. Dr. Zan Mustacchi
    TOPO

  

REFORMANDO PARA INCLUIR

A estratégia de colocar um aluno com deficiência em sala de ensino regular, habitualmente, é acompanhada por grandes preocupações do complexo ‘família-escola-professor’, expressado pela proposta e necessidade de desenvolver um novo plano educacional que, necessariamente, satisfaçam as necessidades individualizadas de cada aluno considerado especial; elaborando planejamentos, através de esforços, com todos os instrumentos e conteúdos conhecidos, propostos ou mesmo questionados.

Um dos principais alicerces de qualquer programa de inclusão está baseado em assegurar e priorizar o acesso do aluno deficiente às acomodações gerais do espaço físico, ampliando suas oportunidades de aprendizagem de todo o conteúdo do programa de educação; promovendo as influências do ambiente espacial, que lhes trarão informações de estrema valia no aprendizado.

O planejamento compartilhado entre a valorização do modelo de vida domiciliar (familial) e o programa educacional, preservando a facilitação do aspecto geográfico, visa fundamentar uma essencial cooperação para a educação de qualidade, onde o relacionamento social e pessoal terá um significado saudável e seguro.

Portanto, podemos concluir que o conjunto ‘mediador (elemento da família), ambiente e professor’ são alicerces às adaptações de aulas específicas para satisfazer às necessidades de cada aluno, selecionando cada uma dessas adaptações, documentando os fatos e as dificuldades que surgem no cotidiano; promovendo conjuntos de prioridades que constituirão potenciais educacionais, visando melhores resultados de aprendizagem e instrução sem, entretanto, comprometer comportamentos e critérios previamente selecionados para satisfazer o currículo de toda a sala de aula (alunos).

Prof. Dr. Zan Mustacchi       TOPO

 

O ELO DO APRENDIZADO

As pretensões, assim como o ideal e a necessidade de construir, são sem dúvida a chave-mestra do entusiasmo da vida onde múltiplos fatores estão envolvidos, sendo a capacitação profissional um dos alicerces dessa estrutura.

A didática está intimamente relacionada com um vínculo empírico através da empatia pessoal entre o aluno e seu professor. Visando a capacitação do aluno, o professor deve transmitir, com responsabilidade e entusiasmo, a experiência que foi adquirida através da prática e dos conhecimentos técnicos que acumulou com o passar dos tempos, aproximando o aluno ao cotidiano das necessidades sociais, dando-lhe bases para determinações morais e decisões individuais; evitando, desta forma, que determinadas situações gerem uma repugnância por ignorância ou mesmo por temor, por mais catastrófica que possa lhe parecer a situação.

A consciência dos nossos limites confere a certeza da capacidade de reconhecer até onde sabemos, o que podemos fazer, como e quando. Devemos ter conhecimento de onde e de quem pode colaborar com nossas propostas, idéias e na resolução de nossas dúvidas, que são progressivas, partindo-se do princípio da necessidade do conhecimento.

No ensino, assim como na prática, devemos preservar de forma ética, os princípios pessoais da família e do aluno, respeitando seus padrões culturais e religiosos; participando-lhes, no momento e de forma oportuna, todas as informações possíveis por nós concluídas e conhecidas; oferecendo-lhe o universo dos conhecimentos e das situações que possam conferir-lhes respostas coerentes nas resoluções do objetivo da educabilidade. E é importante lembrar que os nossos próprios padrões éticos e morais poderão interferir na atitude dos nossos alunos. Devemos ter consciência de que temos a obrigação de apoiá-los dentro do que lhes foi ensinado.

Várias são as formas didáticas para atingir este objetivo básico e, dentro desta expectativa, devemos recordar alguns aspectos primários dos modelos clássicos de educação.

A vivência prática do cotidiano pedagógico, associada às dificuldades que iniciam-se no primeiro contato da tríade aluno-família-professor com a percepção dos limites da formação profissional, vinculada aos problemas de interpretação do processo de aprendizado e do desenvolvimento neuromotor, dará ao professor uma condição de elaborar o melhor e mais apropriado modelo de ensino para cada aluno.

 Prof. Dr. Zan Mustacchi     TOPO

 

AMIGOS

Em textos anteriores enfatizamos a importante necessidade do inter-relacionamento entre a tríade ‘educador-aluno-família’, para obter as melhores informações vinculadas com a especificidade da aptidão e do melhor modelo educativo para o aluno. Embora haja um evidente alicerce na estrutura acima referida, há um pré-requisito que favorecerá as habilidades e o desenvolvimento do aluno, sob uma perspectiva correlacionada não só com sua idade cronológica, mas com a habilidade (desenvolvimento) neuromotora que relaciona-se com a educação em ambientes compartilhados, integrando ao conjunto seus relacionamentos de amizade.

O processo da inclusão visa também discutir os relacionamentos entre alunos portadores de deficiências e não-portadores de deficiências, os quais tem maior probabilidade de desenvolver aptidões sociais, que jamais teriam se convivessem com grupos de mesmas capacitações físicas e/ou intelectuais.

A proximidade física, juntamente com as interações sócio-educativas, promovem uma consciência e um respeito entre a diversidade dos comprometimentos, expressos por vários modelos de deficiência, que devem encorajar as amizades sem, entretanto, forçá-las. A comunidade da sala de aula conflui no processo de proporcionar uma sensação de ‘turma’, que atua no mesmo terreno com objetivos muito similares, sendo estes a educação e a alfabetização estabelecida pela auto-estima de cada um dos elementos envolvidos.

Prof. Dr. Zan Mustacchi      TOPO

  

DOGMAS NUTRICIONAIS 1

As sutilezas da natureza humana são evidenciadas já nos nossos ancestrais, conhecidos como trogloditas, onde a aprendizagem de qualquer procedimento requeria um conhecimento relativo a fatos, conceitos e princípios que levassem a cabo um determinado objetivo, definido por nós como tarefa e caracterizado outrora como uma condição de realização.

Em nossos dias, a Genética Molecular e o "pseudo-domínio" do Genoma Humano equivale ao marco do domínio do fogo e do descobrimento da roda. Em nossos ancestrais já existia a necessidade da perpetuação da espécie (o egocentrismo do DNA em perpetuar-se) e a partir da prole é que esse processo mantém esta condição.

Morávamos em cavernas e já nos preocupávamos com a segurança, pois fazíamos ou procurávamos cavernas em penhascos onde, obviamente, acarretaríamos dificuldades geográficas aos grandes predadores de nossa espécie. É importante considerar que o nosso bebê é, indubitavelmente, um dos menos precavidos para defesa e sobrevida, devido a sua inabilidade em movimentar-se durante os primeiros meses de vida, bem como só conseguir expressar-se através de sons (choros e gritos) que facilmente atrairiam os grandes carnívoros, portanto somos sempre considerados como ‘presa fácil’.

A nossa mãe troglodita somente saia da caverna para distâncias muito curtas quando colhia frutas e outros vegetais, enquanto que seu companheiro, caracterizado como caçador, saia em busca de proteína animal. Ao retornarem, o pai alimentava-se e quando satisfeito dividia com a sua companheira, que já havia feito uso do alimento por ela colhido. Ao bebê era oferecido o seio e nada mais até o momento em que este conseguia movimentar-se; provavelmente já havia sentado antes e estava começando a engatinhar, este era o momento de desenvolvimento neurofisiológico que ampliava o seu pequeno universo, dando-lhe a oportunidade de recolher restos de frutas e outros vegetais que sua mãe deixara cair na sua proximidade. Paralelamente ocorria a erupção dentária, que permitia-lhe, de forma progressiva, a uma mastigação e favorecia uma digestão com uma melhor maturação, oportunizando até uma degradação de proteínas animais.

Com essa pequena explanação quero enfatizar que o aleitamento exclusivamente materno é amplamente suficiente e estritamente necessário, pelo menos do ponto de vista da evolução antropológica, até o evidente momento da erupção dentária, considerando que este marco é paralelo a um desenvolvimento neuromotor que permite ao nosso bebê deslocar-se e que, a partir de então, de forma progressiva, devemos considerar um complemento alimentar que inicia-se com frutas, legumes e verduras e culmina ao término de toda a erupção da arcada dentária (20 dentes de leite) com a introdução da proteína animal. Novamente caracterizamos que a constatação do conhecimento vai progredindo a medida que a aprendizagem oferece um procedimento suficientemente significativo para o desenvolvimento.

Prof. Dr. Zan Mustacchi      TOPO

 

Estresse e Terapias Alternativas


SYLVANIA KABILJO Terapeuta e Educadora do CEPEC-SP (Centro de Est. e Pesq. Clín. de S. Paulo); Graduada pela FFLCH/USP e Licenciada pela Faculdade de Educação da USP; Consultora em Metafísica da Saúde, especializada nas áreas de: Acupuntura Auricular, Shiatsu, Shantala, Cromoterapia, Florais de Bach, Reflexologia, Moxabustão e Ventosa.


Estamos vivendo momentos de mudanças profundas, em que as grandes tensões são diferentes de outros tempos. Para o homem das cavernas, o estresse seria se deparar com um animal feroz. Quando isso acontecia, seus músculos se retesavam, o coração disparava, a respiração acelerava e seu corpo se preparava para lutar ou fugir. Ele corria, ou arremessava algo sobre o animal, lutava se fosse preciso, mas no fim, quando já passado o perigo, o corpo relaxava, e tudo voltava ao normal e as alterações fisiológicas ocorridas em função da luta se estabilizavam, as taxas de hormônios se normalizavam e o homem preservava a saúde.

Hoje, a diferença quanto ao tipo de estresse é enorme, a correria do dia-a-dia, a violência, as pressões sociais, o desemprego, a busca da sobrevivência, e muito mais concorrem para desestruturar-nos a cada minuto. Inúmeras pesquisas foram feitas, por vários profissionais da saúde, principalmente na área médica, e todos são unânimes em relacionar diversas doenças tais como: cardíacas, câncer, distúrbios metabólicos, como o diabetes, distúrbios hormonais, como da glândula tireóide e vários outros, sendo que os problemas apareceram depois de um grande desgaste do organismo físico e psicológico.

O estresse pode ser definido como um conjunto de reações desenvolvidas pelo organismo quando este é submetido a uma situação que exige esforço de adaptação. Emoções negativas poderosas, pensamentos de hostilidade e medo, mágoas, tristezas prolongadas provocam mudanças fisiológicas complexas por meio da liberação de hormônios via glândulas: pituitária e supra-renais. A onda de transformações no organismo é dramática rápida e complicada. Mas é possível perceber, o aumento da pressão sanguínea, ritmo cardíaco, e até mesmo vasos coronários que podem entrar em colapso. A causa de tais patologias, não está nos acontecimentos externos, mas na importância que eles têm para nós. Na verdade, o estresse resulta da maneira como nós encaramos os fatos diários em nossa vida e não deles mesmos. Tudo na vida passa, seja bom ou ruim, o que podemos fazer é tentarmos de cada situação que vivenciarmos retirar o aprendizado positivo. Na realidade o estresse está dentro de nós e não se manifesta, por exemplo, no ato de um divórcio, ou na perda de um ente querido, mas sim no medo de perder quem amamos, ou de ficar sem as coisas que valorizamos, ou no medo de recebermos uma crítica pessoal. Nem mesmo a morte é tão ameaçadora quanto o medo de morrer.

O estresse age ao longo da mente para o corpo. A mente pensa, armazena informações e raciocina, mas é o corpo que expressa, que armazena os sentimentos e é nele que se guarda todo o estresse. Nos tempos das cavernas o maior perigo para o homem que saía a caça era encontrar inesperadamente um animal feroz, naquele momento aflorava o medo e o homem corria, movimentava o corpo e seu organismo se re-equilibrava. Hoje, o homem é sedentário, sofremos o estresse e continuamos parados, na maioria das vezes assentados, no carro, no escritório, etc.

O processo de estresse dura em média sete segundos: ao tomar contato com o fato estressante, o cérebro registra a ameaça, enviando sinais ao hipotálamo, que dispara um alarme, e em seguida tem inicio a liberação de hormônios para levar mensagem a várias partes do organismo que precisa reagir à ameaça, entre eles estão cortisona, adrenalina, hormônios do crescimento, epinefrina, norepinefrina, prolactina e outros. Quando prolongado, o estresse afeta o sistema imunológico, pois as glândulas do timo e as células do sistema linfático também são prejudicadas. Como resultado as células brancas diminuem em número, sujeitando o organismo a infecções e envelhecimento prematuro.

O estresse traz como sintomas, modificações do humor, depressão, pânico, ansiedades, modificações no teor de colesterol, distúrbios glandulares, hipertensão, taquicardia, mudanças no funcionamento dos intestinos, bruxismo, vitiligo, e tantas outras doenças consideradas psicossomáticas. Quais seriam então os tratamentos e cuidados necessários, para nos livramos do estresse, ou mesmo para preveni-lo o que seria o ideal. Já que podemos concluir, que estresse se inicia no campo emocional e energético, as terapias alternativas e energéticas seriam uma ótima possibilidade para sua resolução ou cura, desde que os cuidados fossem freqüentes e contínuos, pois as mudanças nem sempre positivas ocorrem em nossa vida a cada minuto. As terapias são as mais diversas, Acupuntura, Auriculoterapia, Meditação, Florais, Cromoterapia, Ioga e outras. Que serão buscadas através da afinidade de cada um, e, diga-se de passagem, todas promovendo a melhora tanto no campo físico quanto no emocional e psíquico.

O trabalho do autoconhecimento, a busca de nossa essência e da verdadeira identidade é que nos ajudará a achar o caminho da felicidade e alegria de viver.

    TOPO

 

SERÁ MESMO QUE DOMINAMOS O GENOMA?

Com grande impacto, surpresos, ansiosos e, de certa forma, eufóricos recebemos recentemente a seguinte informação: O genoma humano está desvendado!!!...

O que é? Como é? E agora? Será que dominamos realmente o segredo da vida?

Em um infeliz discurso o atual presidente norte-americano citou entre linhas "...dominamos o segredo de Deus!!...", mal sabe ele (comedor de hamburguer, batata-frita e Coca-Cola) que estamos muito longe da sua insaciável onipotência e intransigência, ele parece que quer ser o ‘Dono do mundo’.

A verdade ainda ninguém domina. E se eventualmente somos ingênuos a ponto de acreditarmos que um dia dominaremos, eu lamento dizer-lhes que nem seus tataranetos viverão este dia! Mesmo considerando o avançar de exponencial progressivo do conhecimento e "domínio" da genética, que muitos afirmam: "Um ano de pesquisas, atualmente, gera informações que ultrapassam a vinte anos anteriores".

Genoma é a coleção de genes com as instruções para produzir um ser humano. Células são estruturas que contém, em seu núcleo, 46 cromossomos que armazenam as informações que instruem o funcionamento do organismo; Cromossomos são elementos contidos neste núcleo e responsabilizam-se pelo pool de DNA com informações gênicas que são cerca de 100 mil genes, os quais se combinam para formar as características individuais e compõem o genoma humano; O DNA é a matéria-prima dos cromossomos, composta por sequências de 4 substâncias químicas, definidas como bases nitrogenadas A,T,C e G. Quando ocorre uma alteração da sequência lógica destas bases define-se um erro genético, chamado de mutação, e a consequência desta pode resultar numa doença genética.

Estima-se que existam de 3 mil a 4 mil doenças hereditárias. A doença genética ocorre a partir de uma mutação (erro), que pode ser transmitida com a reprodução do gene defeituoso dos pais para os filhos.

Já em meados do século XVII Francis Bacon pensava na ciência como um instrumento por excelência necessário para melhorar a vida da humanidade, garantindo o bem-estar dos indivíduos. Busca-se aí um elo entre o tradicional e o moderno, estando em jogo a ilusão de que a ciência é o remédio para a cura de todos os males que afligem as populações mundiais. É anunciada a possibilidade do fim da miséria humana.

Talvez seja uma mera coincidência, mas "promessas de esperança" em torno do Projeto Genoma Humano previram um futuro harmonioso e sadio para todo o planeta. Esse futuro (presente) talvez tenha começado a ser delineado já no século XVI até parte do XVIII com as frequentes experimentações públicas, nas quais os cientistas produziram uma verdadeira espetacularização da pesquisa em andamento, muitas ocorriam em praças públicas e terminavam por reforçar e legitimar a imagem do "homem de ciência".

Considerado o verdadeiro iniciador da ciência moderna, Bacon preocupava-se em compreender as causas dos fenômenos naturais. A partir da verificação e da observação, o cientista era visto como capaz de desvendar os mistérios da natureza e da origem do homem que viessem a proporcionar o aprimoramento da espécie humana. Essa busca pela perfeição, não podemos deixar de ressaltar, nos remete à filosofia grega.

No diálogo entre Sócrates e Diotima, descrito por Platão no Banquete, a busca pela perfeição e pelo Belo coloca o homem na perspectiva de alcançar o status de semi-deus. Platão é determinista ao colocar o nascimento como o divisor de água entre a imortalidade, própria dos deuses, e a mortalidade.

A imortalidade e a juventude tem sido ansiosamente desejada, desconsiderando-se todo e qualquer modelo divino que, da forma mais perfeita com a maior da incógnitas, gerou o milagre da vida. Acreditem, somos realmente imortais, pois o ‘egoísmo’ do DNA que nos foi transferido e que transferiremos para as próximas gerações é, na sua grande maioria, imutável e, portanto, uma parte de nós sempre persistirá, enfatizando a nossa imortalidade delegada pela suposta ‘força divina’.

Considerado como uma das maiores realizações da ciência em todos os tempos, o Projeto Genoma Humano está próximo de identificar todas as informações genética contidas nos cromossomos humanos. Essas informações chamadas genes, determinam nossa vida desde a concepção. Governam o desenvolvimento do embrião e do feto, as diversas fases de crescimento e maturação de nosso corpo e, finalmente, seu envelhecimento.

O que conseguimos com a decodificação no Projeto Genoma Humano foi conhecer a ampla variedade dos métodos que representam a posição dos genes em cada cromossomo, expresso em pares de bases com genes colocados em uma ordem atualmente bem conhecida; determinando o domínio da sequência linear de nucleotídeos para cada um dos cromossomos humanos. Conseguimos desenvolver métodos de clivagem clínica, de replicação enzimática e de interrupção controlada por uma sequência de DNA. A quebra ou fragmentação do DNA, realizado por uma enzima definida como DNA-polimerase, favoreceu o domínio do enigma da sequência das quatro bases, denominadas de nucleotídeos. Estes nucleotídeos, que constituem o DNA e o RNA, são bases nitrogenadas conhecidas pelas iniciais A.G.C.T.U. (Adenida – Guanina – Citosina – Tinina – Uracila, esta última sendo exclusiva do RNA). Atualmente com o advento de sequenciamento automático e informatizado, usando marcadores específicos de bases nitrogenadas, conseguimos traduzir a inscrição das informações contidas nas moléculas de DNA, portanto podemos "ler" com facilidade a informação contida nos genes, por meio de uma tecnologia conhecida como sequenciamento de DNA. A sequência de "letras" varia de gene para gene. As diferentes sequências (com centenas ou milhares de nucleotídeos) são as "palavras" da informação genética, contidas nos genes. Os genes estão abrigados em nossos cromossomos, que seriam os "livros" dessa biblioteca da vida, existente em cada uma de nossas células, que compõem o genoma de cada cromossomo, conforme parte do modelo, onde determinou-se uma sequência de 108.970 letras ou bases nitrogenadas, que compõem o genoma do cromossomo 21:

 

gatcaaagcagccacttttgccgaaggggtgcatcattcagacaaggctcatgctccaga
gagatctgttatatttacactgtggattgtcaaacctgcagatctaactctctgtacctg
tgcagctaagtcatgtatctcaaaggcatcaattaaaatattttagggttacttgtgaga
taagattttaatacagattaatctaaacaagctgtcaaccagcagataacaggaccttga
agacttatgacacagagaagcaattaatatggaggtcaggaataggagaaggaagtatct
gtgtgcctggagccagaagtagggatggacgcgttaaaataaattacagtaacctcccca
ttgtttgttggtttaaacacttcaggcaatggttctgcatgggtatgattacagcatttt
cctcaattcataattttattcttgaagcttggaatcttatcttctggagtccgtccatat

ctttgaagctgaaattggaaattctaactgcgatctgagcaaagttccacagctgatttg

ccttttttttttttcctgaagcaaagtcagttgagaaatcccacactgcaaaccttgtct

tttctcagtgatttattggctattttgattccatctgcaatggtttgctccgtggtttgt

gccaaacattttaaatgcttaagagtcaatcaaaacgctatcttcctcaaggaaaagtca

agtcacccaatctggaacattttatatttcggttgtaaatgaagccttaattctgactgt

agactggctctcacttcagggatgcaaaacacgaatgatcttttcctgtatctcaaggac

cacatgccactgtgttccgccttcaacatgtgtaagaatttctgctgtttgtcaaaatgc

taacaggaatgacaccaggaatatcctatagtagtagcttaattttacccacataaaaac

atttcattttatgtctcacgtgtttttcatacatgcctattatgtttctttttgttccaa
actgattatcagtgtttgactgtaaggtaaataaaataccattaattagggaaaggacta
attggtccaatttggagaaatgctgataatcaaattggtgtaccttcttgtattacaagt
gacattttgtaacagtttccaggttttaattatgatgagcttgcatttcaaagaactaat
taaggtttcttattgtttcttttgtagccaaacattttaccccaaggctaccaaggaaga
aaagacaaaggcagacatctgcaatttttaaagcagcttcttattcctcgctcttcctct
atttactaaaaaagaatatgtgtttagagtggagaggggcatgttgggggaaggtgggga
agtaagggatggggagagaggagggtgggaggaaaaacaagaccactcacttcttgggtt
cttggcactccaagaatgatttggtgatagtttgatgagtcatagaaaattttcttggta
gatgaacaataaaaatgaatatttattcatttacccatttaagaaatgtttgatgcctag
cagaagctaaggcagtgttctaggtactaggacagtagtaataaatgaatagtctttact
ccccagagacctgcaaaatagtggaggagacaggaatatagagtaggtaagtatgcacga
agaaaatacacaggtagataaacatgtagagaaaataacttatcttttatttcaagattt
caaaattatgaagtaaaagtaatttgtgacttgtgttgagatttatgccctctattagac
gaagcctgaaatacgtaagagaaatctagatcagtactgtacaataaaaataggatgtga

 

O Genoma é o conjunto dessas informações, incluindo uma grande quantidade de DNA que não forma "palavras": cerca de 3,5 bilhões de nucleotídeos e um total de genes funcionais estimado entre 80 a 150 mil. O conhecimento do genoma humano, que implica decifrar não só a sequência dos genes como o controle de sua expressão (como e onde devem funcionar no organismo), está revolucionando a pesquisa científica, principalmente na prática médica.

As diferenças entre os indivíduos são, em larga medida, determinadas por pequenas variações nos genes. Algumas delas são óbvias, como a cor da pele e do cabelo. Mas diferenças genéticas também influenciam, por exemplo, nossa susceptibilidade ou resistência à determinadas doenças. A informação contida nos genes pode sofrer alterações, espontaneamente ou através de agentes como as radiações, os poluentes, produtos químicos, drogas e etc. Essas alterações – chamadas mutações – podem causar doenças genéticas e, conforme o caso, serem transmitidas através das gerações. Assim, conhecer nossos genes, saber o que cada um deles controla no organismo, entender como eles funcionam, ou silenciam, nas diversas fases de nossa vida, são informações fundamentais para o progresso da medicina.

O emprego do conhecimento sobre sequências gênicas aliado às tecnologias de sequenciamento automatizado de DNA (derivados do Projeto Genoma Humano) constitui um pacote científico e tecnológico conhecido como genética genômica.

As aplicações da genética genômica já são visíveis em diversas especialidades médicas, como na oncologia. O estudo da genética do câncer progride rapidamente, com duas frentes principais: a descoberta de genes que atuam no processo de origem do tumor e das metástases e a identificação de genes que nos tornam susceptíveis ao câncer, por exemplo o gene BCL6 e o gene BRCA2 controladores de leucemia e câncer de mama respectivamente.

O próximo desenvolvimento na área da genética genômica é o estudo da expressão gênica diferencial, isto é: como os genes são "ligados" ou "desligados" num determinado tecido, ou na formação de um órgão, podendo-se correlacionar que o ciclo de vida e a morte celular programada (apoptose) são elementos controlados por genes, que quando comprometidos por alguma mutação, acarretam a interferência no modelo da expressão esperada do ‘ligar’ ou ‘desligar’ o desenvolvimento de um tecido.

No futuro, a terapia será ajustada ao perfil genético do paciente, caso a caso, o que, sem dúvida, mudará as perspectivas da medicina, já na primeira década do século XXI.

A meta final deste sequenciamento molecular, definido como o paradigma do genoma humano, é criar um mapa físico que determine um conhecimento através da representação da posição dos genes em cada cromossomo. Reconhecendo-se, então, uma ordem da colocação destes, poderemos determinar padrões de normalidade e desvio dessa e, até o momento, entendo que este delineamento oferece-nos múltiplas perspectivas próximo-futuras vinculadas primariamente com o que sempre enfatizei: O mais importante é termos possibilidade de diagnósticos prematuros para que possamos elaborar modelos preventivos e oxalá um dia propor uma verdadeira terapêutica de cura.     TOPO

Referências bibliográficas:

  • Benedito Mauro Rossi e Mauro Pinho. Livro: Genética e Biologia Molecular para o Cirurgião. Editora Lemar, 1999;
  • Genoma, Espaço da Saúde, Fascículo de Divulgação da Enfermagem do Hospital Israelita Albert Einstein;
  • Guga Dorea e Rosemary Segurado. Título: Proposta de artigo para São Paulo em Perspectiva. Agosto, 2000;
  • Zan Mustacchi e Sergio Peres. Livro: Genética Baseada em Evidências – Síndromes e Heranças. CID Editora, 2000.    TOPO

 

TRANSFORMANDO-SE NUM SER SÓCIO-SEXUAL

A adolescência e início da idade adulta evocam cuidados especiais e desafios para os jovens. É o período de mudanças sociais e emocionais assim como desenvolvimento e maturação sexual. Isto acontece com todos os adolescentes. Mudanças físicas são geralmente dramáticas conforme estas crianças experimentam um crescimento abrupto e o despertar sexual. Encarando as tarefas de se tornar uma pessoa sócio-sexual, aprendendo a viver independentemente de suas famílias estes jovens em geral ainda precisam de proteção e liderança de sua unidade familiar. Assim, possíveis conflitos nascem do desejo por liberdade e independência e da necessidade de segurança acoplada a realidade da dependência.

As mudanças rápidas que ocorrem durante a adolescência durante o crescimento físico e na aparência querem dizer que os jovens devem desenvolver uma nova imagem de si mesmos e aprender a conviver com uma nova aparência física e novos impulsos biológicos.

Os mais desenvolvidos enfoques curriculares encorajam pais e profissionais a prover educação sexual cedo na vida da criança. É importante informar ao jovem a respeito das mudanças que ele ou ela devem esperar antes que elas ocorram.   TOPO

Prof. Dr. Zan Mustacchi


A SEXUALIDADE DOS DEFICIENTES VISTA DE FRENTE
Caracterizar jovens com comprometimento e/ou deficiência como incapazes de aprender sobre aptidões sócio-sexuais é impróprio e não traz resultado algum. É mais adequado dizer que seu comprometimento intelectual meramente os isola de experiências comuns e do núcleo de informações que outros adolescentes sem retardo acumulam através de experiências incidentais. Em outras palavras, jovens com comprometimento intelectual são "como as outras pessoas" com relação à ocorrência do desenvolvimento sexual. É verdade que os estágios do desenvolvimento sócio-sexual podem ser brevemente retardados para eles, mas, como adolescentes, eles exibem as mesmas necessidades de sentir-se parte do grupo e de intimidade como os adolescentes "normais". Eles tendem a imitar seus pares no estilo de suas roupas e modo de falar, e o comportamento deles é moldado por excitações internas associadas com a puberdade e por interações ambientais externas comuns. Porém, por causa do seu comprometimento intelectual e das restrições que podem ser impostas sobre eles, nem sempre experimentam a satisfação em grupo, festas, socialização pelo telefone, experiências na comunidade e todas as outras exposições interpessoais necessárias para aumentar seus conhecimentos e habilidades em relacionamentos sócio-sexuais. As conseqüências disso são o desenvolvimento inadequado e deficiente e ainda frequentes experiências interpessoais embaraçosas.

Irregularidades no desenvolvimento podem também levar à lacunas no amadurecimento que podem causar ansiedade adicional para o adolescente com comprometimento intelectual. Estas irregularidades podem surgir no nível físico como interferência no crescimento e desenvolvimento de características sexuais secundárias resultantes de um problema no coração, ou esterilização precoce ou um nascimento anormal. Num nível psicológico, irregularidade podem surgir como uma falta de uma imagem bem definida do corpo, conceito próprio insatisfatório, indiferença ao ambiente, privação sensorial e ambiental (especialmente para aqueles que são isolados), a inabilidade de variar o pensamento ou a falta de forte identidade pessoal.

Assim, parte dos problemas de ajustes para as pessoas com comprometimento intelectual podem relacionar-se com deficiências físicas ou psicológicas; todavia, um aspecto mais importante, se por nenhuma outra razão a não ser a sua inevitabilidade, é que estes jovens com comprometimento intelectual são tipicamente privados de oportunidades de experimentar atividades com outros adolescentes. Para reiterar, treinamento de habilidades sócio-sexuais é essencial para todos os jovens, mas especialmente crucial para jovens com deficiência. Isto porque estes últimos freqüentemente não tem oportunidades de adquirir esta consciência através dos canais típicos de socialização e eles não aprendem bem da forma incidental.   TOPO

Prof. Dr. Zan Mustacchi



COMO COMPORTAR-SE
Comportamento efetivo sócio-sexual envolve a aplicação intrincada de habilidades motoras, cognitivas e afetivas que são cuidadosamente exibidas de acordo com as circunstâncias, o ambiente e a pessoa. Estas atitudes sociais consistem das seguintes habilidades e comportamentos:

  1. Comportamentos motores não verbais (por exemplo: expressões faciais, gestos, aparência);
  2. Comportamentos verbais (por exemplo: agradecer pessoas, "bater papo", fazer perguntas apropriadas);
  3. Comportamentos afetivos (por exemplo: expressar atitudes e sentimentos, responder de modo empático);
  4. Habilidades sociais cognitivas (por exemplo: resolver problemas interpessoais, assumir papéis, pensar com empatia, reconhecer sinais sociais, entender normas sociais, articular uma seqüência de comportamentos e pensamentos).

Alguns discutem a irritação causada em membros da comunidade pela incompetência social daqueles com comprometimento intelectual. Em resultado da liderança destes programas de vida independente estão enfocando cada vez mais o treinamento de competência em habilidades sociais. Desde 1970, vários projetos de pesquisa de treinamentos de habilidades sociais tem incorporado jovens com comprometimento intelectual dentro de suas populações a serem "treinadas". Os resultados mostram que embora "treinamentos" de habilidades sociais sejam tarefas extremamente complexas que envolvem uma combinação de habilidades não verbais, verbais, afetivas, cognitivas e motoras, é apesar disso possível ensinar estes comportamentos para pessoas com comprometimento intelectual. Tecnologias estão disponíveis para ensinar estas habilidades para populações com variadas expressões de comprometimento intelectual. Também é significativo que estas pesquisas indiquem que o melhor método de ensino parece incluir uma combinação de ensaio ativo, "feedback" dos pais e gerenciamento consistente de comportamento. Esta conclusão sustenta a tremenda necessidade da parceria entre pais e profissionais no ensino apropriado de habilidades sócio-sexuais.

Para jovens com comprometimento intelectual o método mais usado e mais bem sucedido consiste no uso de modos visuais de instrução, prática positiva (brincar de desempenhar um papel e ensaiar) e reforço de contingente.  TOPO


Prof. Dr. Zan Mustacchi

 

Voluntariado

O milênio inicia-se com o 'Ano Internacional do Voluntário', o qual ao que tudo indica envolve-se emocionalmente na atitude solidária, principalmente aos menos favorecidos; que muitas vezes são traduzidos como potencialmente inúteis à sociedade, ou então doentes de grande peso para a mesma.

Na década de 60 - "Anos de Ouro" - um poeta, cantor e talvez um dos maiores ídolos da juventude da época, John Lennon, cantava em sua música Imagine: o amor, a solidariedade, a compreensão, o credo e a vida; pleiteando que todos se unissem para uma igualdade. O eclodir da vontade dessa igualdade renasceu neste milênio, tentando despertar programas de assistência, promovendo mobilizações coletivas que muitas vezes foram traduzidas como "voluntariados".

Ser um voluntário deve, ao meu ver, ter uma conotação um tanto quanto diferente daquela que estamos assistindo (não que esta seja inadequada ou inapropriada), deve ser primeiramente vinculada a uma prévia e reconhecida capacitação do elemento que se propõe, como um voluntário, a oferecer seus diferenciados conhecimentos para uma comunidade ou um elemento sem, contudo, cobrar honorários; abrindo mão, portanto, de horas de seu trabalho de produção remunerada para melhor favorecer um terceiro.

O importante é reconhecer que o termo 'fazer caridade' significa necessariamente ceder algo de si que lhe faça falta e não o que você pode desvincular-se; obviamente dividir, ceder, ajudar, colaborar, melhorar a condição de seu próximo tem um grande mérito, mas é importante que todos ser empenhem ao oferecer parte de seu conhecimento íntimo para o crescimento assistencial.

Dar o seu único pedaço de pão ao seu próximo quando você estiver com fome, isto é uma evidente caridade. Dar um pedaço de você pode salvar uma vida.

We touch the future when we teach - Tocamos no futuro quando ensinamos - este é o mais importante papel, que espera-se na educação e na saúde, que o nosso país aguarda.  TOPO

Prof. Dr. Zan Mustacchi

NOVIDADES EM SÍNDROME DE DOWN

Ultimamente tem sido rediscutida a influência do metabolismo dos Monocarbonos (Folato e Vitamina B12) e sua relação, vinculada aos mecanismos de não disjunção dirigidos de forma específica aos componentes genéticos de polimorfismo da Metileno Tetra HidroFolato Redutase (MTHFR 677) quanto da troca de Citosina por Tiamina e da mesma enzima 1298 na troca de Adenina por Citosina, bem como da Metionina Sintetase (MTR 2756) onde ocorre uma mutação da Citosina por uma Guanina como também da Metionina Sintetase Redutase (MTRR 66) com troca da Adenina por Guanina e níveis elevados de Homocistina.

Baseado nas evidências de que as alterações do MTR 2756 C/G com MTRR 66 A/G e a elevação da Homocistenemia tem sido indicativos de indutores de não disjunção cromossômica, concluiu-se que as alterações do metabolismo de metilação do Folato podem induzir o DNA à hipometilação e segregação cromossômica anormal, que aparentemente tem sido encontrada em 91% das mães com elevação da mutação MTHFR 677 C/T com MTRR 66 A/G e hiperhomocistenemia.


Prof. Dr. Zan Mustacchi

 

UMA QUESTÃO DE NOBREZA

Há milhões de anos, uma célula primária de vida passiva (que não dependia de gasto energético para sua sobrevivência, utilizando apenas água e oxigênio), sentiu-se vulnerável e procurou uma parceria que pudesse oferecer-lhe "força" (energia). Naquela situação, ocorreu a união da célula de vida passiva com um microorganismo de vida ativa (que produzia sua própria energia para obter uma melhor qualidade de sobrevida).

Prof. Dr. Zan Mustacchi

Originou-se então, uma célula com mitocôndrias (bateria energética indutora da energia vital chamada de ATP - Adenosina trifosfato) que ao que tudo indica foi uma simbiose de uma bactéria com uma célula primária.

A atividade elétrica mensurada (eletrocardiografia, eletroencefalografia, eletromiografia, etc.) expressa a vitalidade celular que por sua vez está exclusivamente relacionada com a atividade mitocondrial, sendo a mitocôndria uma estrutura definida como organela citoplasmática (portanto não está no núcleo da célula), que contém um cromossomo em forma de anel (anular) o qual assemelha-se em mais de 99% em estrutura ao cromossomo de uma bactéria conhecida como E Colli e este é o motivo pelo qual acredita-se em um processo evolutivo da simbiose de uma célula primária com uma bactéria adaptada.

Chamo a atenção para o fato de que o número de cromossomos de uma célula é determinado pelo universo de seu material genético e o número de 46 cromossomos está relacionado somente com os cromossomos do núcleo, não sendo considerados portanto, os cromossomos existentes nas mitocôndrias, que são citoplasmáticas e de número muito variável entre os grupos celulares até do mesmo sistema. Este número (de mitocôndrias) varia de forma intimamente relacionada à atividade de produção energética necessária para a referida célula.

Até muito recentemente desconhecíamos comprometimentos hoje conhecidos como doenças mitocondriais e conseqüentemente qualquer alteração genética estava delegada a alterações dos cromossomos exclusivamente nucleares.

O núcleo, até onde se conhece, é o local onde se inicia e evolui o processo de multiplicação celular ou duplicação de informação genética que caracteriza nossa denominada mitose, que contém as informações do genoma.

As células dividem-se em uma velocidade variável e ao que tudo indica, quanto mais rápido é o processo de divisão e multiplicação celular (conhecido como mitose), mais curto é o ciclo de vida e o programa de morte celular (apoptose). Por este motivo, há maior possibilidade destas células sofrerem uma freqüência de mutação, cujo exemplo mais apropriado é a ocorrência de uma desorganização da divisão nuclear com conseqüentes alterações, principalmente na estrutura cromossômica acarretando o que chamamos de mitoses atípicas que são o principal marco das neoplastias (câncer).

Considerando-se o processo acima, passamos a entender de forma clara a íntima relação de tecidos que desenvolvem mais freqüentemente neoplasias com a aceleração da velocidade de multiplicação de suas células originárias. Como sabemos que a via respiratória e digestiva tem a mesma origem embriológica, estes tecidos se assemelham muito e estão em permanente multiplicação e descamação celular, que segundo algumas referências bibliográficas tem um ciclo vital de 15 a 21 dias. A pele que recobre o nosso corpo também está em constante renovação por descamação e o ciclo dessas células é de cerca de 15 dias. Tal processo enfatiza a evidência de neoplasias (ou alterações cromossômicas) destes tecidos numa freqüência maior que em outros sistemas do corpo humano como, por exemplo, o sistema nervoso (tecido considerado nobre) que raramente expressa neoplasias quando comparada à freqüência desta evidência nos tecidos anteriormente referidos.

Nas últimas décadas do milênio passado notou-se a íntima relação entre a doença de Alzheimer e a estrutura cromossômica do braço longo do cromossomo 21. Em um estudo multicêntrico realizado nos EUA com indivíduos institucionalizados com mais de 60 anos de idade e com Alzheimer, encontrou-se uma alta freqüência de aneuploidias com trissomia do 21 em biópsia de pele do antebraço (indivíduos estes que não tinham a SD). Este achado associado à indução de placas amilóides no SNC sugeriu fortemente uma condição de que pudesse existir indivíduos com mutações celulares do SNC para células com a referida aneuploidia acarretando Alzheimer. Em conseqüência, investiu-se na suposição de que uma forma de diagnóstico prematuro de um prognóstico evolutivo para Alzheimer poderia ser obtido fazendo-se biópsias seriadas em pele de indivíduos nos quais houvesse a possibilidade de herança de riscos familiares.

Ao considerarmos tal possibilidade, poderíamos talvez afirmar que o envelhecimento que ornamenta-se das mais variadas formas de aneupoidias neoplásicas preservaria os tecidos nobres de lesões, isto justificaria porque apesar do indíviduo apresentar desde cedo uma expressão de mosaico celular da trissômia do 21 em sua pele, o quadro de Alzheimer se apresenta tardiamente com relação a outras aneuploidias não neurológicas.

Investigações paralelas na década de 1980 comprovaram que em nosso fígado existiam estruturas celulares com aneuploidias e mosaico. Tal situação permite-nos novamente abordar um fenômeno muito questionado quanto a maior ou menor proporção a neoplasias de um determinado grupo de tecido ou sistema mais ou menos induzidos ou correlacionados a fatores ambientais mais evidentes em uma determinada genealogia. Após tantos questionamentos e incertezas poderíamos novamente presumir, e porque não afirmar, que se os diferentes comprometimentos sistêmicos de maior ou menor expressão, verificados em indivíduos com SD por trissomia simples (avaliados em sangue periférico) não seriam em virtude de mosaisismo segmentares. Portanto, os tecidos com maior expressão da aneuploidia manifestariam maior comprometimento.

Ao interpretarmos o parágrafo anterior podemos deduzir que até o intelecto ou o potencial de capacitação e as habilidades cognitivas possam sofrer as mesmas repercussões do universo de aneuploidias encontrado nos tecidos correspondentes a essas funções. Então como poderíamos afirmar tão prepotentemente que não há "graus" de habilidades intelectuais em indivíduos com SD? Será que voltaremos a modelos retrógrados de classificação de castas? Será que em algum momento poderíamos mensurar o quanto de potencial nos é pré-determinado pela condição genética? Mas por outro lado se usamos só 10% do nosso SNC, e portanto do potencial intelectual, como poderíamos selecionar nossos neurônios "perfeitos" e excluir atividade daquele com aneuploidias?

Estamos perante uma delicadíssima tarefa de rever conceitos e preconceitos, no foco da intelectualidade, ou melhor, da "deficiência mental" dos indivíduos com SD.

O comprometimento intelectual tem sido indicado como o mais deletério processo que envolve a SD, mesmo que a meu ver o componente mais deletério seja o preconceito social, não podemos deixar de dar razão ao valor da pergunta dirigida à expectativa intelectual.

Deste modo, o modelo da abordagem das inteligências múltiplas proposto por Gardner, pode ser entendido não só como um evento ambiental (capacitação a partir das oportunidades proporcionadas), mas também a coexistência de equilíbrios cromossômicos das vias neuronais específicas nas quais o indivíduo se destaca. Não existem ainda evidências da quantificação da concordância ou discordância com estudos em gemeralidade monozigótica do perfil de distribuição e comportamento das inteligências múltiplas nestes indivíduos que possa traduzir e quantificar as responsabilidades da genética e do ambiente.



 TOPO




FECHAR JANELA